Polymerase Chain Reaction (PCR) Protocol

Materials

• GoTaq 2x PCR Mix containing:
  • Taq polymerase
  • dNTPs
  • PCR reaction buffer
  • Loading dye
• The primer stock for the PLIP3 contains both:
  • Forward primer: ATGGAGGGTGTTTTCTTAAAAAT
  • Reverse primer: TCACTTGAAGAAACTAAAATGTGCTTG
• Purified Water
• Template DNA samples
• PCR machine
• Mini tube spinner

Procedure

1. Use a fine black Sharpie to label six 0.2 ml PCR tubes with the same ID you labeled your DNA
2. Determine how many PCR reactions, and you will make a “Master mix” that will be used for all the PCR reactions
   • The number of DNA samples plus one extra for pipetting error
   • The master mix will be aliquot into each of the PCR tubes, this will minimize the difference between the reactions
3. Do the math and fill in the 3rd column in the table below:
   

   Procedure

   Reagent	Volume for Single Reaction	Volume for the Master mix
   GoTaq Mix (2x conc.)	15 μL	μL
   Primer stock (10 picomolar of both primers)	2 μL	μL
   Purified water	11 μL	μL
   Total volume	28 μL	μL

4. Take a 1.5 ml Eppendorf tube, and add in the reagents listed in the 3rd column below to make the master mix and vortex lightly
5. Mix the mixture by tapping the Eppendorf tube lightly
6. Take 28μL of the above PCR master mix into the pre-labeled PCR tube
7. Add 2 μL of the DNA or water to the tube indicated by the open boxes in the table
   • Make sure you change tips between mixing each tube
8. Close each PCR tube lid tightly
9. Mix each tube by spinning the tubes for 5 seconds in the spinner
10. Keep all reaction tubes on ice until instructed to place them in the thermocycler
11. The thermocycler is preset at the following reaction conditions:
    

    Thermocycler preset reaction conditions

    Step	Temperature	Time	Number of Cycles
    Initial Denaturation	95°C	2 min	1
    Denaturation	95°C	0.5 min	30
    Annealing	55°C	0.5 min	30
    Extension	72°C	2 min 30s (1min/kb)	30
    Final Extension	72°C	5 min	1
    Soak	4°C	infinite	1